Regenerative medicine has received considerable attention because of its potential role in healing or replacing apoptotic cells. Mesenchymal stem cells (MSCs) isolated from multiple adult human tissues can differentiate into multiple lineages and are attracting increasing interest in many fields [1-3]. Adipose-derived mesenchymal stem cells (ADMSCs) are an ideal source of MSCs because of their abundance and surgical accessibility compared to those of other tissues [4,5]. According to a study, stem cells are divided into embryonic stem cells, MSCs, and induced pluripotent stem cells (iPSCs) [6]. The International Society for Cell Therapy has recommended baseline characterization of MSCs’ potential for multilineage differentiation and expression of the clusters of differentiation (CD), including CD73, CD90, and CD105 [7,8].

ADMSCs are typically isolated in three steps. Step I, the surgically obtained fat tissue is divided into 1 cm³ pieces. Step II, digestion of fat with collagenase type I at 37°C for 1 h. Step III, the digested solution was filtered through a 70 µm filter to remove debris. Subsequently, ADMSCs are isolated by collecting the cells via centrifugation.

MSCs have three important biological properties that make them a practical alternative. The first is their ability to differentiate into various cell lineages. The second is their ability to migrate to damaged tissues and promote repair. The third is its ability to regulate broad cellular immunity [9,10]. Initial MSCs treatment was based on their migration into damaged tissue, insertion, and differentiation into functional cells to regenerate the tissue. This study aimed to culture and characterize ADMSCs.

This study was approved by the Institutional Review Board (IRB) of Yeungnam University Hospital (IRB No. 2017-11-009), and the requirement for informed consent was waived.

1. Adipose-derived mesenchymal stem cell isolation and culture

Adipose tissue was obtained from consenting patients (n = 3; 2 male and 1 female) during posterior lumbar decompression surgery performed at our hospital. Primary cells were isolated and cultured as previously described [11,12]. The collected adipose tissue was washed three to four times with 70% EtOH and phosphate-buffered saline (PBS; Gibco Invitrogen, Carlsbad, CA, USA) to remove blood and debris. Washed tissues were minced using scissors and blades. Tissues were digested in collagenase type I (2 mg/ml, Sigma-Aldrich, St. Louis, MO, USA) for 1 h at 37°C. The digested samples were subjected to a cell strainer (pore size = 70 µm, Falcon; BD Biosciences, Coning, NY, USA). Afterwards, it was centrifuged at 3,000 rpm for 10 min. Cell pellets were cultured in a 5% CO₂ incubator in low-glucose Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen, Carlsbad, CA, USA) containing 10% fetal bovine serum.

2. Cumulative population doubling level analysis

The proliferative capacity of the cultured cells was measured using a previously described method with some modifications [11]. The growth and proliferation capacities of the cultured cells were estimated using the cumulative population doubling level (CPDL) with the formula CPDL = ln(Nf/Ni)ln2, where Ni is the initial number of cells cultured, Nf is the final number of cells harvested, and ln denotes the natural logarithm. Cells (7 × 10⁴) were seeded in triplicate into 6-well culture dishes and subcultured every 2 days. Subsequently, the cells were counted and subcultured. To estimate the CPDL, the population doubling of each passage was measured and added to the previous cell population doubling level.

3. Reverse transcription–polymerase chain reaction

Total RNA was isolated from cultured cells using TRI-solution (Bioscience Technology), and the RNA concentration was measured using a multiple plate reader according to the manufacturer’s instructions. Information on the primers used for reverse transcriptase polymerase chain reaction (RT-PCR) is presented in Table 1. Relative gene expression levels were determined by normalizing to GAPDH as an internal control.

Table 1 . Primer sequences for reverse transcription PCR.

Primer		Sequences (5’ → 3’)
OCT4	F	CTTCAGGAGATATGCAAAGCA
	R	ACACTCGGACCACATCCTTC
SOX2	F	TTGCCAATATTTTTCAAGGAGA
	R	CAAGACCACAGAGATGGTTCG
KLF4	F	AGGCACTACCGTAAACACACG
	R	GGAAGCACTGGGGGAAGTC
MYC	F	GCGACTCTGAGGAGGAACAA
	R	TGCGTAGTTGTGCTGATGTG
GAPDH	F	CGCTGAGTACGTCGTGGAGT
	R	GGAGGCATTGCTGATGATCT
AP2	F	AAGAAGTAGGAGTGGGCTTTGC
	R	CCACCACCAGTTTATCATCCTC
PPARγ	F	TTGGTGACTTTATGGAGCCC
	R	CATGTCTGTCTCCGTCTTCTTG
Osteopontin	F	GAGACCCTTCCAAGTAAGTCCA
	R	GATGTCCTCGTCTGTAGCATCA
Osteocalcin	F	GAGCCCCAGTTCCCCTACCC
	R	GCCTCCTGAAAGCCGATGTG
Collagen I	F	CACAGAGGTTTCAGTGGTTTGG
	R	GCACCAGTAGCACCATCATTTC
Aggerican	F	TCAGGAACTGAACTCAGTGG
	R	GCCACTGAGTTCCACAGA

4. Fluorescence-activated cell sorting analysis

To determine the expression of cell surface markers, we analyzed the cells using flow cytometry. To analyze mesenchymal stem cell markers, 1 × 10⁵ cells were incubated with PE-conjugated CD105 (Bio-Rad, Hercules, CA, USA, MCA1557), PE-conjugated CD90 (BioLegend, San Diego, CA, USA, 555596), PE-conjugated bound CD73 (BioLegend, 344004), FITC-bound CD45 (BioLegend, 555482), FITC-bound CD34 (BioLegend, 343504), and PE-bound CD14 (Bio-Rad, MCA1568), and incubated for 2 h. SubEsequently, it was centrifuged at 2,000 RPM for 10 min and washed 2 times with 500 µl of PBS. Cells were resuspended in phosphate-buffered saline (PBS). At least 10,000 events were observed by flow cytometry. Data analysis was performed using BD FACSDiva software version 6.1.3 (BD Biosciences, San Jose, CA, USA).

5. Multi-differentiation ability

To confirm the multipotency of human adipose-derived MSCs, the cells were cultured in osteogenic differentiation medium (StemPro Osteogenic Differentiation kit, Gibco Invitrogen), adipogenic differentiation medium (StemPro Adipogenic Differentiation kit, Gibco Invitrogen), or chondrogenic differentiation medium (StemPro Chondrogenic Differentiation kit, Gibco Invitrogen). The cells were cultured in 6-well plates. The differentiation medium was changed every 2 days for 3 weeks. Differentiated cells were fixed with 10% formalin for 1 h and stained with oil red O, alizarin red S, and Alcian blue for 10 min at room temperature.

1. Image of ADMSCs isolation

Isolation of ADMSCs can be divided into three steps. Step I: Wash adipose tissue in PBS and 70% EtOH and remove blood vessels and other tissues. Step II: Minced fat tissue was digested with PBS saline containing collagenase type I. After filtering, the remaining tissues were pelleted via centrifugation. Step III, cell pellets were seeded in DMEM containing 10% FBS. Media were replaced every 2 days, and subcultures were performed (Fig. 1).

Figure 1. Adipose-derived mesenchymal stem cell image. Wash and cut human adipose tissue into small pieces (step I), perform collagenase digestion, remove the supernatant by centrifugation (step II), and isolate ADMSCs by filtration (step III).

2. Extraction method of human ADMSCs

Adipose tissue stored in PBS was washed with 70% EtOH and PBS (Fig. 2A). Washed tissues were used to separate the blood vessels (Fig. 2B). Adipose tissue was washed once or twice with PBS (Fig. 2C). Afterwards, the tissues were minced using scissors (Fig. 2D, E). The chopped tissue was digested in PBS mixed with collagenase type I at 37°C for 1 h (Fig. 2F, G). Cells were filtered from the digested sample using a 70 µm filter (Fig. 2H, I). Cells were collected by centrifugation at 2,000 rpm for 5 min (Fig. 2J). After removing the supernatant from the sample, the cells were resuspended in DMEM supplemented with 10% FBS (Fig. 2K). For seeded cells, the medium was replaced after 48 h (Fig. 2L).

Figure 2. Isolation of mesenchymal stem cells from human adipose tissue. Human adipose tissue after surgery (A). Separation of adipose tissue and blood vessels (B). The adipose tissue was cut into uniform pieces and washed (C). The adipose tissue divided into smaller pieces (D, E). Type I collagenase (F). Adipose tissue digestion using type I collagenase (G). Filtration of the digested samples (H, I). Cells using centrifugation (J). Cell suspension (K). Cell culture volume (L).

3. Characterizing the mesenchymal stem cells of human adipose tissue

After the isolation and culture of primary stem cells from human adipose tissue, the ADMSCs showed a spindle-shaped morphology typical of MSCs and were attached to the plastic culture dish surface. We observed the morphology of the MSCs from passages 1 to 15 and confirmed that their morphology remained unchanged (Fig. 3A). For cell proliferation assays, we measured and calculated the cell population using CPDL. Cells were seeded in a 6-well culture plate and subcultured for 2 days. This was repeated until we observed a decrease in the proliferation rate from passages 5 to 15. The growth rate curve steadily increased through the accumulation of the population (Fig. 3B). To measure gene expression level of MSCs markers, RT-PCR was performed. MSCs markers, such as OCT4, SOX2, KLF4 and c-Myc, showed expression patterns as a function of stem cell characteristics (Fig. 3C). Cell surface-specific markers were confirmed by fluorescence-activated cell sorting (FACS) analysis to identify the immunophenotypes of ADMSCs. Normally, MSCs show specific cell surface markers. According to the International Society of Cell Therapy, MSCs positively expressed CD73, CD90 and CD105, but negatively expressed CD14, CD34, and CD45 surface antigens [7]. FACS analysis revealed that ADMSCs had an expression pattern identical to that of MSC immunophenotypes. The results showed that ADMSCs expressed positive signals for CD73, CD90 and CD105, which are well-known MSC markers. However, the cells were negative for the expression of other immune cell markers (CD14, CD34 and CD45), hematopoietic cells (CD34 and CD45), and macrophage markers (CD14). These results showed that the immunophenotype of ADMSCs was consistent with that of the other MSCs (Fig. 3D).

Figure 3. Characteristics of human adipose-derived mesenchymal stem cells. Representative bright-field microscopy images of human ADMSCs (original magnification 40×, scale bar = 250 µm, 100×, scale bar = 100 µm) (A). Cumulative doubling of ADMSCs via in vitro expansion (B). Reverse transcription polymerase chain reaction analysis of stem cell-specific gene expression in ADMSCs (C). Flow cytometry analysis showing non-expressing (CD14, CD34, and CD45) and expressing (CD73, CD90, and CD105) human adipose MSCs (fluorescence on the horizontal axis and cell count on the vertical axis) (D). p: passage; ADMSCs: adipose-derived stem cells.

4. Induction of multi-differentiation ability of ADMSCs

To demonstrate the ability of ADMSCs to differentiate. We confirmed the multi-differentiation ability of MSCs in two ways: specific staining and gene expression patterns. ADMSCs were cultured in adipogenic induction medium for 3 weeks and oil red O staining was performed to confirm adipogenesis. Fatty droplets were detected during adipogenic differentiation (Fig. 4A). Additionally, we examined the gene expression levels of adipogenic-associated markers such as Adipocyte protein-2 (AP2), and Peroxisome proliferator-activated receptor-γ (PPAR-γ) via RT-PCR. Adipogenic markers increased under differentiation conditions compared to basal culture conditions (Fig. 4B).

Figure 4. Differentiation potential of human adipose-derived mesenchymal stem cells into adipocytes, chondrocytes, and osteoblasts. From the left, adipocytes (40×, 100×) oil red O staining, chondrocytes (40×, 100×), Alcian blue staining, osteoblasts (40×, 100×), and alizarin red S staining.

To investigate chondrogenesis, ADMSCs were cultured in chondrogenic induction medium. After 3 weeks, Alcian blue staining was performed to confirm chondrogenesis. ADMSCs were cultured in chondrogenic induction medium and incubated in an acidic solution of Alcian blue stain supplemented with guanidinium hydrochloride. After 30 min, the blue color indicated the proteoglycan compounds produced by the chondrocytes (Fig. 4A). We also examined the gene expression levels of chondrogenesis-related differentiation markers, such as collagen type I and aggrecan, using RT-PCR. Chondrogenic markers increased under differentiation conditions compared to basal culture conditions (Fig. 4C).

Additionally, we treated ADMSCs with osteogenic induction medium for the same period as in previous experiments. Alizarin red S staining, which positively stains calcium deposits, was used to detect differentiation. Under differentiation conditions, we detected strong positive alizarin red S staining (Fig. 4A). Additionally, we measured the gene expression levels of markers associated with osteogenesis, such as osteopontin and osteocalcin, using RT-PCR (Fig. 4D).

Stem cells can be used to treat inflammatory diseases, including incurable diseases, and various studies have been reported to date. Stem cells can be divided into embryonic stem cells, iPSCs, and MSCs [13,14]. Embryonic stem cells have limited clinical applications because of ethical concerns, carcinogenic potential, and the possibility of iPSCs producing cancer [15,16]. In the case of adult stem cells, they can overcome the limitations of embryonic and iPSCs, so research is reported to use them not only for clinical research but also for research on therapeutic effects.

MSCs are easier to extract, isolate, and culture than embryonic and iPSCs, and are less immunogenic [17,18]. MSCs, as proposed by the International Society for Cell Therapy [7,19], i) adhere to the bottom of a plastic culture dish, ii) specifically express CD105, CD73 and CD90 on cell surface, but CD45, CD34, CD14, CD11b, CD79alpha, CD19 and HLA-DR are negatively expressed, and iii) are multipotent, that is, have the ability to differentiate into adipocytes, chondrocytes and osteocytes [20,21].

Recently, it was reported that differentiation of MSCs into nerve cells containing neural factors is possible [22-24]. In addition to their differentiation ability, the mechanism of MSCs has been confirmed through the therapeutic effects of substances secreted by stem cells [25,26]. They produce and release a wide range of bioactive molecules called stem cell secretions, and proteomic analysis of the secretome has revealed that they contain nutritional factors and cytokines such as growth factors, immune modulators, and antioxidants [27,28]. Therefore, secreted factors from adult stem cells have a variety of functions, including anti-inflammatory, anti-apoptotic, extracellular matrix regulatory, and neuroprotective actions, through protective actions against fibrosis, apoptosis, and oxidative damage [27,29-32]. Adult stem cells can be cultured and isolated from various tissues, and many studies are cultivating them from fat tissue, bone marrow, or umbilical cord tissue and evaluating their efficacy and mechanism studies [33-36].

Numerous studies have substantiated the therapeutic potential and applications of MSCs; however, the precise mechanisms remain elusive. The paracrine effects of MSCs, particularly their secretion of bioactive factors, are believed to play a critical role in their therapeutic efficacy. This suggests that understanding the complex interplay between cell-secreted molecules is the key to unlocking the full therapeutic potential of MSCs in regenerative medicine [37-40].

Our study summarized the method for isolation and culture of MSCs, and the information would be useful for basic and clinical practitioners, especially for the novice researcher. Although that was widely recognized by previous studies, this can be an opportunity to remind the procedure and approach to the world of basic experiments for the clinicians.

In conclusion, from the basic procedures like abovementioned principle, mesenchymal stem cells have been isolated and cultured appropriately. The characteristics for MSC can be also confirmed based on cell culture, FACS, RT-PCR analysis, and multi-differentiation ability results. A variety of experimental and translational studies are necessary to confirm the clinical significance of the stem cells.

This study was supported by grants from the Korea Health Technology R&D Project through the Korea Health Industry Development Institute (KHIDI), Ministry of Health & Welfare, Republic of Korea (RS-2023-00305198) and National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIT) (No. 2022R1C1C1005410).

No potential conflict of interest relevant to this article was reported.